Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15005B7
Clone ID IST15005B7
Vector VICTR78
Project tigm

Sequence tag IST15005B7HMR1
Sequence
AGTGTCTGAGTAAGCCCAAAGAGGACCTGAAATTACAGGACTGTGAGTGGCCTGACCTGGGTGTTGGCANCTGTCCACAG
AGGTCAAAAGAAGGCATAGGGCCTGCTGGGATTGGAATTTCAGATGGCTCAGAACCACCATGTGGGGGCTGGGAATCAAA
CCCGGGCGCTCTTAANTGCANAGCCCTTTCCAGCTTGCTGTCTGTCTGCCTGCCTGCCTGCCTGCCTGCCTGT
Sequence Type genomic DNA
Unitrap ID UNI31688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3046914..3047145 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]


Sequence tag IST15005B7BBF1
Sequence
GCCTGCAATCCTATCAGTTGGGAAACAGGGTAGAAGGGTCAGAGGCCTGATGAAGTTTTAAACCAGTGTAAGCTACAGTA
GACCCCATGTCTTGGTTTATTTTAAGGGGACAGTGCAGGTACGAGCACACACTTCCCTCATAGAGGACTGGAGTTCAGTT
CCTGGCGCTCAGGTCAGGCCGACAGCGCTCANCCTCCTGGAACGCCAGCCTCAGGCAGTCANTATTGTGGGCCANTGANA
ANGCANNNGCNNNTCNNGGNANANANTTNNNCCANNNTGTCCANNNANGGNCCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023764


For any suggestions or comments, please send an email to unitrap@crg.es