Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10801F4
Clone ID IST10801F4
Vector VICTR76
Project tigm

Sequence tag IST10801F4HMF1
Sequence
CATGTAAGTCTAACCACCCAGTGATTACTTAGTTGAATACACAAGCTACACATGCCTGTTATACATCCCAAGGGTTTATT
TCAAGTGCAGAGCACCATACTTATAGCTAAGAAGGGAATCCTGGCTTTGTGTGTTGCATGAGATCAAATCCATGATGAAA
ATACTTTGGCTCAGAGGGGTTCTTGTTTAAGCCTTGAAGTTGGGGACTAAACTTCTGCGCTTAGTCCTGAATTCANGAGT
TTCTGTTTAGGTTCNTGAAATGAGACATGTGACTTCCTATCACAGTANAGGGACATNCACNNTCCCTGCTGANAAACCNT
TGTCNCCANNNAAATANACCN

Sequence Type genomic DNA
Unitrap ID UNI31376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3460392..3460731 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023800 (Tiam2) NM_011878 T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]


Sequence tag IST10801F4BBF1
Sequence
AGTCTAGCCCTGTGACATACCTCTTCCAACAAGAACACACCACTAAGCCTTCCTAAACAGTCTACCAACTGANAACAAAA
TATTCAAAGACAATGCCTATGGGTGCAGGGTATTCTCGTTCAAACCAAATTCTACCCCCCACCCCACCCCTGCCCCCAAG
CTCTGGATTACAGGCATGGACTAGCAGGTCCAGCTTTTTTTTGGTTTTGTGTTTTGTTTTTTTTCANACAGGGTTTCTCT
GTGTAGCCCTGGCTGTCCTGGAACTTACTCTGCANACTAGGCTGGCCTCGAACTCAGANNTCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31425644..31425947 294
NO GENE  

 
Come back to gene ENSMUSG00000023800


For any suggestions or comments, please send an email to unitrap@crg.es