Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14559H7
Clone ID IST14559H7
Vector VICTR74
Project tigm

Sequence tag IST14559H7HMR1
Sequence
NTGGCCCTGGCTGCCTCTGCCTCTGCTGGGATCACAGGTATAGGCCACGATGCCAGCCTCAGTGTTTGTGTTGTATGGAT
TCCNANGAAAACCTCAAAAGAAAGAGGACCCTCTTTACTGTAGTTTGTTTTTTTTAAAATTACTGTTATTTATTTATTAT
TTAATATGAAAACAATCTCCAAACTGAAGTGGCTCTGAGGTAAATCAGGTGTGATTTTGCATTANTTTANAAGATGTGTA
AGTGAAAGGTGACNAATGTCNCTATTTCTAAAATATTGTCCTANNCNNCN
Sequence Type genomic DNA
Unitrap ID UNI30161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37287810..37288091 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]


Sequence tag IST14559H7HMF1
Sequence
NNNNNNGGNNGANNNNGNNNNNNAAAAACANNNNNNNNNNNNNAAAGCCNAATTAANCNNNANGCTGAGTAACNAAGGCT
CACCNNNGCCNNATANAATTACNANTGNGANAAGCCTTCTTCCACANTANAATANATGCCTCTTCTCTTTGCTTTAAAAT
CTGANAAACACGTAAGCAAAGAAACCNNGTTCCACCAAAATTAANTATCTCACACNNAANNANNANCTCTCNNGCCAAGA
AATGGAAGAGATCACAAATTATGCAAATGGTTTACACTTACAAACAGAACCAAAAATTTTACTAACAGAAACCCCTAAGA
AAGTGGACTTTAAGTCAGGGTTCTCAACCTTCCTAATATTGTGAGATCCTTTAATACAGTTCCTCATGCTGTGGTGAGCC
CAACCATAAAAATATTTTCATTATTTCATAACTGCATTTCTGCTGNTTTGAATTATAATGTAATTNAATTGTAATATAAA
CAAAAACAATTTCTANGGTCTTAGGCAACCTCNGNGAAAAAAAAAATCNNTTGATTCCNNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14559H7BBF1
Sequence
CCACATAGTAAGATCCTGCCTCAAAAAAACAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es