Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14768H9
Clone ID IST14768H9
Vector VICTR76
Project tigm

Sequence tag IST14768H9HMR1
Sequence
AATGTCAAAGAGTTTAATAAATGCTTTATAGTATCTTAAAGGGATCTACTTATTGGCTTATAGATTGATCCTAAAACAGC
TACCTTATTAGAAAAGGGAAAAACAGGTTTTCTCCACAAAACGCTTCAAAAACATATTAATTCGTGTGACGAGCTGGTAG
GTAANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777293..115777459 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940388..136940554 165
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919667..52919833 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469662..7469828 165
NO GENE  


Sequence tag IST14768H9HMF2
Sequence
CATTAAAATATTAGATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGA
TACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTA
GTTA
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469665 163
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079359 163
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789429 163
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919830..52919992 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940391 163
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356467..91356629 163
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749561..124749723 163
NO GENE  


Sequence tag IST14768H9BBF1
Sequence
CATTAAAATATTAGATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGA
TACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTA
GTTGACAAAACATTTTAAATACTTGGCTGTAAAGGGGCAGTGACTAATTGCACTTTTAATCAATTTTTTTAAGGAGCAGT
TGTAACTAGAAGGCTTGTAAAGTTATTAAGAGTTACATGTGCATAATTTATTTATTAACTAGAAATATGCATAAGCAATT
GTAAATTTGAGAATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCAGAGATATGGCATTGACNNNNNN
TATACAAATTAAGGTTTGANTGNTTANCANTNNANAACACCATCTACAGCACACNNNTNGATCATCTGTGCTGGANCAGG
GGAAANNGTGTCTNNAGANTCCNCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es