Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_121H12-3
Clone ID CMHD-GT_121H12-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_121H12-3
Sequence
CATTGTGTTTCGGAGACCAAAAATTTAACTTACACGAGGTGGGAAAGGAATTTGACCCCAAAGCAGCTCACCCTGTTCCA
GGCTCCCTGGATGTTTGTTTGATCACAGAAGCACCCCTGGAGGAGGTGATCGAGCGCCTAAAGGCTTTTGATGTCCCCAT
TGAAGAGGGCCCAGTATTCAGAACAGGAGCAAAGGGGCCTATTCTATCCATCTACTTCCGAGATCCGGACAGAAATCTCC
TTGAGGTGTCCAGCTATGTCACTTCATGATTGACACTGGCTTTTTCTTCTATTGTGATCCACAAAATGTCATTTTACCTA
ATTTCCTACAAATCCCAGAGACCTCGAAGAACTGAGAACTTCGGCCACAGGGTTATGGTGGAAACGTTTGTGTCTAGAAA
GCCT
Sequence Type mRNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7581368..7582971 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es