Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14578F5
Clone ID IST14578F5
Vector VICTR74
Project tigm

Sequence tag IST14578F5BBF1
Sequence
ACCATATATCATTTAAAATTCTGATCTTACTCTAATTTGCTTCTCTGTTGCTGTGATAAAACACTAAGGGTTTGTTTTAG
CTCATCATTGGGAAGTCCCAAGGTAGGAACTCCAGGAATATAACTGAAGAAGAAACCTCTGCATAAAGCTGCTTACTGGT
TCCTTCCCCGACTCACATCCACCAACCTTTCTTATACAGACCAGCATCAATTATTATCAAGAAAATTTCCCACAGCCNTG
CCCACAGGCCAATCTGATTGAGATAATTTTTCAACTGAAGGCCCCTCTTCATAGGTGTATCAAATTAATAACAAAACTAA
TCTATATCTATCTACNNNNATATGTATATGATATANANNNCTCTTANGAAAAAAGTTTTCAACTTCAAAAACACTCATGT
TGCAACTCCNACGTCCCTACCTATCTACCCTCATTCTGACANNNCATANCACTAAAATCTGCNATGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87562687..87563154 436
NO GENE  


Sequence tag IST14578F5HMR1
Sequence
TGGTCNTGACAGCATCCACCTTTAATCNCAGCGTTCAGGAGGCAGAAGCTAGTGAATCTCGGAGTTTAGGAGTAACCTGG
TCTTATGAAAACTTTCTCAAATAAAAAAATTGAATGTTTGAAGCC
Sequence Type genomic DNA
Unitrap ID UNI30287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87563151..87563274 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]


Sequence tag IST14578F5HMF1
Sequence
ACCATATATCATTTAAAATTCTGATCTTACTCTAATTTGCTTCTCTGTTGCTGTGATAAAACACTAAGGGTTTGTTTTAG
CTCATCATTGGGAAGTCCCAAGGTAGGAACTCCAGGAATATAACTGAAGAAGAAACCTCTGCATAAAGCTGCTTACTGGT
TCCTTCCCCGACTCACATCCACCAACCTTTCTTATACAGACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87562953..87563154 202
NO GENE  

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es