Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14740G5
Clone ID IST14740G5
Vector VICTR76
Project tigm

Sequence tag IST14740G5HMF1
Sequence
AGAGCACTCTCTGCTGGGAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTCCTCCTGGCCGAAGAA
GAAGGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGA
CTAAATTCCTAAGTTCCTTGGAGTCCCGGGGCCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGG
GCGGGCACCTGTCCTCCGGTCCGGACGGTGGCTGGCTGTCCCCGGCCCACAAAGGGTGCTGCCTNAGCGCCTCNGTGCTT
CTGCCTGTTCCNNAANCTGTCNGGTTCNCNGGNNCNNNNNNTCACCTGTTCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14740G5HMR1
Sequence
TGAGCACTGAAACTNNGAGGAGAGAATCTGTCTCCCAGGTCTGCTGAGAGACGGTAACAGAATCNCCAGAAGAACAATCT
CTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30634 UNI30798 UNI34161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3335146..3335237 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11356666..11356757 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27435507..27435598 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 10705310..10705401 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4813699..4813790 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053499 (EG432723) predicted gene, EG432723 Gene [Source:MGI Symbol;Acc:MGI:3644242]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 10919641..10919732 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9324712..9324803 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 7952794..7952885 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 18979395..18979486 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9202909..9203000 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15383235..15383326 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7374089..7374180 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12231046..12231137 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4196554..4196645 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5403791..5403882 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4042950..4043041 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3741667..3741758 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5242566..5242657 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3146201..3146292 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 923774..923865 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 431264..431355 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 827077..827168 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078466 (AC145587.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 391422..391513 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161913: 56503..56594 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165796: 457757..457848 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165798: 70040..70131 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079059 (AC147709.1)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 45472..45563 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 520898..520989 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 734357..734448 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 421827..421918 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 336108..336199 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166413: 611855..611946 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166415: 242289..242380 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166417: 393796..393887 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 8396498..8396589 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 335976..336067 86
NO GENE  

 
Come back to gene ENSMUSG00000079059


For any suggestions or comments, please send an email to unitrap@crg.es