Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0771
Clone ID AE0771
Vector pGT0lxr
Project sanger

Sequence tag AE0771
Sequence
TTTTTCTCGTCTTCTTANTCGATCTTCTCTGNACTCCTTCATCCATTATTTCTCCTATCTACCCCTCGCTCTCTCGCTAT
CTAGTCTCCATTCTCTTCTTCCCTTCTCATCTCTATTCCTGGGGTATTTGGATTCCCTTTTTTTTCATTTTGATGCCGGG
ACGGAGTTGTAGTTGCTAAGATGACCAAAGTAAAGGCCGCTCCCGAAGAGTCCGAGGCGCAGGCGGAGGGCTGCAGCGAG
GAGCGCACGTACAAAGAGCTGCTGGTCAATCTGAACCCCATCGCGCAGCCCCTGGCTTCCCGCCGCCTGACGCGCAAGCT
CTACAAGTGCATCAAGAAGGCCGTGAAGCAGAAGCAGATTCGTCGCGGGGTGAAGGAGGTTCAGAAATTTGTCAACAAGG
GCGAGAAAGGGATCATGGTTTTGGCAGGAGATACATTGCCGATTGAGGTGTACTGCCATCTTCCAGTTCTGTGCGAGGAC
CAGAACTTTGACCACGCGTATAGATGTTGACTTTTTTTTTTTTTTTTCTTTTGCCTACTTCCCATTCGCTTACATTTTAT
CTTTTTGTCAACATC
Sequence Type mRNA
Unitrap ID UNI2310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51433292..51436064 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001056 (Nola2) NM_026631 nucleolar protein family A, member 2 Gene [Source:MGI (curated);Acc:Nola2-001]

 
Come back to gene ENSMUSG00000001056


For any suggestions or comments, please send an email to unitrap@crg.es