Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14344F6
Clone ID IST14344F6
Vector VICTR74
Project tigm

Sequence tag IST14344F6BBF1
Sequence
AAAAGGCTAAGATAAGAAATGCTGCTGCTGCTTACAATGCATTCTCTTCCCCAGAAACACGCAGGCAGTTAAAGGTGGGA
AACAAAGGAGTGGGATGAGGAAAAACATCGCACCGTTTCAGAGGTAGCTCCTTTAATATCCAGCTCTGCTTCCAGCTGTG
GGTAGAAATGCTCAGAAAATCAGATTTGAGTCTTCACAGGGAAACTTCACTATGAGGATAATTCCTAAAAGACAAAAGAT
GTATCTGATCTAAAGAAACACCAGAGTATTATTAGGGGAATTTATATAAAATTGTGATTTTGTCATGGAACAGGCAGATG
TTTTGGTCCTAAGTATTTTANCTTTGCCTTTCNGNNNTTGCANTATGTGATAGGAATCNNTGATTCCNGACN
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95023194..95023584 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST14344F6HMR1
Sequence
TTTTANAAATCCTGTTTTGTAGAAAGTGTCTCAAAACTTCCAGGTTCTCATTACTTCTTGAAGCAGTATTTGCTTACTGG
CCTGGTANAGGACATTANGGAGGCTCAAGTAATCTTTGAAGTTGATTAAAATGTAACAAACAAACAAAATAATTGGTCTC
CCATTTTGCACAACTGTACCTCTCTGTGGTGCCTCAAATAAGGGTGATTCTTTTCTGGGATTNNTTAATATTCTCCGGGC
TGACGGGANGAAATCCTATGATCTANTACTCCATTGATTAAACCCNTNACTTTGTGCCTANAGGGCTTTTGANNAAAACN
GANTANGCANATAAATAAATANATAAATANNTNTNNATAGATAAATANNTNCNTACATACNTACNAACCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es