Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14408D2
Clone ID IST14408D2
Vector VICTR74
Project tigm

Sequence tag IST14408D2HMF1
Sequence
CCACTGGGTCTGAAGAAGCCCTAGATGCTTGTCCTCTAGTATTGTAGACAGTGGGGTACTGACTGGCTATGGTGCCACTC
AGGAGGGTGAGGCAGGAGGGTTACTATGAGTTCTAGGTTANCCTTATAGAATGAGACCCTGCCTCAAAAAAAAAAT
Sequence Type genomic DNA
Unitrap ID UNI34224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134172608..134172762 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es