Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10227F11
Clone ID IST10227F11
Vector VICTR76
Project tigm

Sequence tag IST10227F11HMF1
Sequence
NAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAC
CCTGTCTCG
Sequence Type genomic DNA
Unitrap ID UNI382 UNI17676 UNI30901 UNI34226 UNI34227 UNI34228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84954978..84955065 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44441867..44441954 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41016799..41016886 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55801505..55801592 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3867922..3868009 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56153042..56153129 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 36891081..36891168 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32379481..32379568 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10630646..10630733 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037196 (Pacrg) NM_027032 Park2 co-regulated Gene [Source:MGI Symbol;Acc:MGI:1916560]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35961243..35961330 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4032082..4032169 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104515345..104515432 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 36476918..36477005 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037325 (Bbs7) NM_027810 Bardet-Biedl syndrome 7 (human) Gene [Source:MGI (curated);Acc:Bbs7-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 19393609..19393696 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31484885..31484972 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3660389..3660476 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20206039..20206126 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 119275605..119275692 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53335535..53335622 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034218 (Atm) NM_007499 ataxia telangiectasia mutated homolog (human) Gene [Source:MGI (curated);Acc:Atm-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 32065..32152 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 84026437..84026524 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052372 (Il1rapl1) interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI (curated);Acc:Il1rapl1-001]

 
Come back to gene ENSMUSG00000052372


For any suggestions or comments, please send an email to unitrap@crg.es