Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14748E3
Clone ID IST14748E3
Vector VICTR76
Project tigm

Sequence tag IST14748E3HMF1
Sequence
GGTGCCTGAGGGAGGGTGCCTGCTGTCCCTCCCCAAGTCAAAATAGTGGGTCCCAGGTGCTTCCCTGCCAGCCCCCAACT
CCCTGGGGCTCCCATTCTTTGTCTTCGAAGACCCGTCCTCCCCTCCCAGCCTGGAGAGGTTGAGGAATCACCTTAGCCTT
GACCCGAGAGGGCGGGCAGAGGAGGGGCAGGCAGCCCTCACCCTGCCTCCTGCCCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25936339..25936557 219
NO GENE  


Sequence tag IST14748E3BBF1
Sequence
CCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCC
Sequence Type genomic DNA
Unitrap ID UNI32210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35413605..35413649 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118932382..118932426 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140004006..140004050 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26761963..26762007 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054823 (Whsc1l1) NM_001001735 Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]

 
Come back to gene ENSMUSG00000054823


For any suggestions or comments, please send an email to unitrap@crg.es