Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0767
Clone ID AE0767
Vector pGT0lxr
Project sanger

Sequence tag AE0767
Sequence
AGGTTGTAAAAGTTAACATGAACAAACTACGGCAAAGCTTCAGGAGAAAGAAAGACGTTTATGTCCCAGAGTCCAGCCGT
CCACATCAGTGGCAGACAGATGAAGAAGGAGTCCGCACTGGAAAGTGTAGCTTCCCAGTTAAGTACCTCGGCCACGTAGA
AGTTGATGAGTCAAGAGGAATGCACATCTGTGAAGATGCCGTAAAGAGATTGAAAGCTGAAAGGAAGTTCTTCAAAGGCT
TCTTTGGAAAA
Sequence Type mRNA
Unitrap ID UNI2311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85166209..85183310 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021224 (Numb) NM_010949 numb gene homolog (Drosophila) Gene [Source:MGI (curated);Acc:Numb-001]

 
Come back to gene ENSMUSG00000021224


For any suggestions or comments, please send an email to unitrap@crg.es