Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11433C6
Clone ID IST11433C6
Vector VICTR76
Project tigm

Sequence tag IST11433C6HMF1
Sequence
CTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAG
GACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI14452 UNI15140 UNI26736 UNI33426 UNI34230 UNI34231 UNI34232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793036..4793150 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7525538..7525652 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015757 (Ppil4) NM_026141 peptidylprolyl isomerase (cyclophilin)-like 4 Gene [Source:MGI Symbol;Acc:MGI:1914668]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19394335..19394449 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8376934..8377048 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 56438004..56438118 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19156337..19156451 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021774 (Ube2e1) NM_009455 ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107411]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51808647..51808761 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10054690..10054804 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7341975..7342089 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 26160671..26160785 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6214315..6214429 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024786 (1700123I01Rik) RIKEN cDNA 1700123I01 gene Gene [Source:MGI Symbol;Acc:MGI:1923913]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6645706..6645820 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002107 (Cugbp2) NP_001103702 CUG triplet repeat, RNA binding protein 2 Gene [Source:MGI (curated);Acc:Cugbp2-009]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84667559..84667673 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028086 (Fbxw7) NM_080428 F-box and WD-40 domain protein 7 Gene [Source:MGI (curated);Acc:Fbxw7-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57174797..57174911 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33541706..33541820 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30017207..30017321 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058440 (Nrf1) NM_010938 nuclear respiratory factor 1 Gene [Source:MGI (curated);Acc:Nrf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3625498..3625612 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019734 (Tmc4) NM_181820 transmembrane channel-like gene family 4 Gene [Source:MGI (curated);Acc:Tmc4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 8136503..8136617 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99538508..99538622 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53811028..53811142 115
NO GENE  

 
Come back to gene ENSMUSG00000019734


For any suggestions or comments, please send an email to unitrap@crg.es