Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10918H10
Clone ID IST10918H10
Vector VICTR76
Project tigm

Sequence tag IST10918H10HMF1
Sequence
AAACCAGGTCCTCAAAAGGGCAGCTAGTGCTCTTAACCNTTGAGCCCTATCTTTCAGCCCTGATGTTAATTTCTAAAAGT
AATGTAGTTGAGGTAACTTAACCCTGCCAAGACAGACAGTACATAAATAAGTGCAATGTTACTCGCTGCAAGTATTATTA
ACTAGAATGAACAGGTAAGCTCACTTACATCCTCCTCAGAGATACAGTAGCACTCACCTTCATTCCCTAAAACAAGCTCC
TCAGCCAAATGTCACACCAAAATACCACCTNGAGATTTTAAACAGACATTAGGCTCTGCTACTCCTTCTCCCAACATCAG
TCTTTATATTTGGACNNTTTGANGAAAATGTAAACNATTACNTANNACAACCCTGAGTGCCTNNCTCTTTTCTGAGACAT
GAANGAAGAACNNCCATTAAACTCTCCNGTACTATATGAGCTCAGTGCACGCTTCTNAAAACAACATTCAAGAAGACTGA
AAAATGAAACCTGACTGANTAANAAGTTGCTGAGAAAAGAGTAACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70320769..70321294 486
 
EST/CDNA Est Name
  CJ076210.1 - CF727184.1 - CB522067.1 - CN724359.1 - CD546657.1 - CN725421.1 - CN715501.1 - CN715944.1 - CV558548.1 - BY721993.1 - CF531610.1


Sequence tag IST10918H10HMR1
Sequence
GTTTNAATTCCCAGCACCCACATAGAGGCTCACAACCATATGTGATTCTAGTTCCACAGGCCCTTTTCCTTATGCATTAG
TCACATCCTTATATACATTATATACATGCAAAAGAGCACTTGCACACATAAAAAAAGAAAGGCAAGAAAGCAAGCATACA
GAGCAGCAAACATTTATCTGGGGAAGCATACATCAAAATGAACCTAACATATAACAGTCTAATGTCCACATGATACAGAA
TAATAAAAGCTCTACAAAAGCATAAATAAATTTCTTCTTCAGAGAGTCTTTTTTTTGTTGTCGTTGAAACANGGTTTTTC
NCNGGGTANCCCTGGCTGNCCTGAANCN
Sequence Type genomic DNA
Unitrap ID UNI22841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70320428..70320772 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST10918H10BBF1
Sequence
AAACCAGGTCCTCAAAAGGGCAGCTAGTGCTCTTAACCNTTGAGCCCTATCTTTCAGCCCTGATGTTAATTTCTAAAAGT
AATGTAGTTGAGGTAACTTAACCCTGCCAAGACAGACAGTACATAAATAAGTGCAATGTTACTCGCTGCAAGTATTATTA
ACTAGAATGAACAGGTAAGCTCACTTACATCCTCCTCAGAGATACAGTAGCACTCACCTTCATTCCCTAAAACAAGCTCC
TCAGCCAAATGTCACACCAAAATACCNNCTCGAGATTTTAAACAGACATTANGCTCTGCTACTCCTTCTCCCAACATCAG
TCTTTATATTNGGACCATTTGAGGAAAATGTAAACNATTACATAAAACAACCCTGAGTGCCTNNCTCTTTTNTGANACAT
GAANGAAGAACCACCATTNAACTCTCCNGTACTATATGANCTCAGTGCACGCTTCTNAAAACAACATTCNAGNNNCTGAA
AAAATGANACCTGACTGANTAANAAGTTGCTGAGAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es