Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_114F8-3
Clone ID CMHD-GT_114F8-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_114F8-3
Sequence
GCTTGATGTGTCCGGGGCAGACATATTAGCCAAGTCAATCTCTAACTCCCAGGTAGAGGTTCTGGAAAACTGTGGCCATT
CGGTAGTGATGGAGAGACCGAGGAAGACAGCCAAGCTCATTGTCGACTTTTTAGCTTCTGTGCATAACACAGACAACAAG
AAGCTGGACTGAGGCTGTTGCCACAGCTTGCATTGTGCACACAGCATCTGCTCCCATCCCCAAAACCTGACACAGTAACC
ACTCTCAGGGATCCTGCCCCAAATGCTGTCTGAGCACCAACAGCCCTGAGGAAGCCAGTTGCCTATCCCAGTATCCTTGG
TTCCACAGAGCATCAAGGGCCACAAGAAACTCT
Sequence Type mRNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8887987..8888339 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es