Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10945H3
Clone ID IST10945H3
Vector VICTR76
Project tigm

Sequence tag IST10945H3HMR1
Sequence
TTCTTCGGCCNGAGGAGGTCCAAATACAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTG
AGCACTGAAACTCAGAGGAGAGAATCTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACAATCTCT
AAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30565 UNI30566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114637..114807 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48166..48336 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134076..134246 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15336842..15337012 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 13740306..13740476 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13282633..13282803 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145505..19145675 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369649..4369819 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6672739..6672909 165
 
EST/CDNA Est Name
  CB272803.1 - AA066383.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689690..9689860 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826469..7826639 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4771173..4771343 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025892 (Gria4) NM_019691 glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7461978..7462148 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056940 (AC127584.3) NP_001019883 Putative uncharacterized protein LOC544988 [Source:UniProtKB/TrEMBL;Acc:Q7TMK7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255609..5255779 165
 
EST/CDNA Est Name
  CB272803.1 - AA066383.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912877..3913047 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3770461..3770631 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110466..5110636 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4601811..4601981 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641538..5641708 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4442637..4442807 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7843163..7843333 165
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616222..11616392 165
NO GENE  


Sequence tag IST10945H3BBF1
Sequence
TATTATGTGTCGGGAGGAATTTCTTTTCTGGTCCAGTCTATTTGGAGTTCTGTAGGCTTCTTGTATGTTCATATGCATCT
CATTCTTTAGATTTGGGAAGTTTTCTTCAATAATTTTGTTGAAGATGTTTGCTGGACCTTTGAGTTGAAAATCTTCATTC
TCATCCACTCCTATTATCCGTACGTTTGGTCTTCTTATTGTGTCCTGGATTTCCTGGATATTTTGAGTTANGATCTTTTT
GCATTTTCCATTTTCTTTGATTGTTGTGCCGATGTTCTCTATGGAATCTTCTGCACCTGANATTCTCTCTTCCATCTCTT
GTATTCTGTTGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCTAGTGTTGCCTCGCTTTGA
GTTTTCTTTATTGTGTCTACTTCCCTTTTTAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI35164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 102946987..102947422 432
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028520 (4921539E11Rik) RIKEN cDNA 4921539E11 gene Gene [Source:MGI Symbol;Acc:MGI:1918191]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 114999191..114999626 432
NO GENE  

 
Come back to gene ENSMUSG00000028520


For any suggestions or comments, please send an email to unitrap@crg.es