Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002G4
Clone ID IST15002G4
Vector VICTR78
Project tigm

Sequence tag IST15002G4HMF1
Sequence
GACNNAGTAAGGGTGGGTGGAGGGACTCTGTCTAGGTGAGGAACAGGAAAGGAAGACTTCCATTTCTTTCCCTAAAGTAG
TACTTCTATTAAAAAAACCACACTCTCTCTCCGAGCTTCCTCTGAGCCTACAAGGAATAAAACTGATAATCTCTGTGACC
CGATCCCCACAAACAAGGGAAGCAATGTCATAACTCTAAGCCGTGAGGTTTCTCACTGCCTGTGGGTGCTCNTATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73584757..73584992 228
NO GENE  


Sequence tag IST15002G4HMR1
Sequence
GGTCTCGAGTATCCCAGGCTGGCCTTGAATTNNCTCTGTAGCTGGGATGATTCTGAATTCCCCATCCTTTTGCCTGCTTC
TCTAGAGTGCTGGATTAAAGGCGTATCCCACCGCTCTTGGTTTACAAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI11610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73584629..73584760 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST15002G4BBF1
Sequence
GACCAAGTAAGGGTGGGTGGAGGGACTCTGTCTAGGTGAGGAACAGGAAAGGAAGACTTCCATTTCTTTCCCTAAAGTAG
TACTTCTATTAGAAAAACCACACTCTCTCTCCGAGCTTCCTCTGAGCCTACAAGGAATAAAACTGATAATCTCTGTGACC
CGATCCCCACAAACAAGGGAAGCAATGTCATAACTCTAAGCCGTGAGGTTTCTCACTGCCTGTGGGTGCTCTTATTCTGT
GTTTGCTCANTGACTGTGACCTCAGGGGTTTTANNNNGTGTGNCNGCTGTTTGCCTTGGGCCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73584757..73585059 289
NO GENE  

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es