Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14442B3
Clone ID IST14442B3
Vector VICTR74
Project tigm

Sequence tag IST14442B3HMF1
Sequence
AACCAAACCAAAAAACGCCACATTTCCCAAGAAGCCCTTTCAAAGGGAAAGGTGGCGCATGCTTGGTCTCCCACTCTAGG
GAATTAAATGGAACTACAATTCCCAAGAAGCCTCATATTACAGTTCATCCAATCAGTGCTATATATAAGCTATCGCGAGA
CTTTTATGAGCCTCCATTCTATAAGCTCATGGGAATTGGGCTGGGCCATCCTTTTCANCCAAGATGGCNCCNAAAGCGAA
GAAGGAAGGTATGTTGCGGTATGGGAATCNGTCNNGTCNGTCTTGN
Sequence Type genomic DNA
Unitrap ID UNI27053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996984..77997268 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058546 (Rpl23a) NM_207523 ribosomal protein L23a Gene [Source:MGI (curated);Acc:Rpl23a-001]


Sequence tag IST14442B3BBF1
Sequence
AACCAAACCAAAAAACGCCACATTTCCCAAGAAGCCCTTTCAAAGGGAAAGGTGGCGCATGCTTGGTCTCCCACTCTAGG
GAATTAAATGGAACTACAATTCCCAAGAAGCCTCATATTACAGTTCATCCAATCAGTGCTATATATAAGCTATCGCGAGA
CTTTTATGAGCCTCCATTCTATAAGCTCATGGGAATTGGGCTGGGCCATCCTTTTCAGCCAAGATGGCGCCGAAAGCGAA
GAAGGAAGGTATGTTGCGGTATGGGAATCTGTCAGGTCGGTCTTGGATACCCGCAGAGCGAACTCGCGGGGAAGAAGAAT
GCCCGGCTAAGCCATGGGGGGCTTGTTCTGTGGCTACTGTCGCGACTAGGCNCCGCTGCGGGGTATGANGACCGCGTGGG
CCAANCCGCATGGGCTGGTTCCAGTGCNGGGGATTGNCNAAGCCNCCGGGCCNGCAGCGGCNNCCNNTGATGGN
Sequence Type genomic DNA
Unitrap ID UNI27053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996796..77997268 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058546 (Rpl23a) NM_207523 ribosomal protein L23a Gene [Source:MGI (curated);Acc:Rpl23a-001]

 
Come back to gene ENSMUSG00000058546


For any suggestions or comments, please send an email to unitrap@crg.es