Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12614E1
Clone ID IST12614E1
Vector VICTR76
Project tigm

Sequence tag IST12614E1HMF1
Sequence
ACTTAGCTGGGTCTAAAGCTCAACTCAAGGCATCAGTACCTTCCCTGTGTTTTATTTTTAAATATTGGATCTCCTTTCGC
GTCTATTTTCTTCCGAAGCAGCAGCTGCGGTGGCCCAGCAAGCTAGCCTCCCTTGCTTCTTTCTTAACACCTTTTGTTAC
TGAAGATGGGCTTTTTCTGTGCAAACTGTTTTCTTTCACCTTTCAGTAGCAGTTATTTATTAGACAACCAACCTTCCAGG
CCTTCTGCAGGGTATACAGCTCTCCCACTGCTAAGGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21693407..21693689 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]


Sequence tag IST12614E1BBF1
Sequence
ACTTANCTGGGTCTAAAGCTCAACTCAAGGCATCANTACCTTCCCTGTGTTTTATTTTTAAATATTGGATCTCCTTTCNC
GTCTATTTTCTTCCGAANCANCANCTGCGGTGGCCCAGCAAGCTANCCTCCCTTGCTTCTTTCTTAACACCTTTTGTTAC
TGAAGATGGGCTTTTTCTGTGCAAACTGTTTTCTTTCACCTTTCNNTAGCAGTTATTTATTANACAACCAACCTTCCNGG
CCTTCTGCAGGGTATACAGCTCTCCCACTGCTAAGGAGTTAACCNTACTCCTGGATGGGCGANAAGGANACAGATACNAG
TCCNTAGCCNTATCCNGTACNACTGCNATAGAAAGCCCTCAGANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028251


For any suggestions or comments, please send an email to unitrap@crg.es