Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13682G7
Clone ID IST13682G7
Vector VICTR74
Project tigm

Sequence tag IST13682G7HMR1
Sequence
NCTATAAGCCNATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTG
AAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTG
TCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079418 220
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789488 220
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777134..115777355 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356408..91356629 220
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940450 220
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919771..52919992 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469724 220
NO GENE  


Sequence tag IST13682G7BBF1
Sequence
CCATTAGGTACACAAACTGCACTTAAGGGAAGTCCCAGCANCANATGGCCAACATAAAACAAACTTATTGGTATTTTTGG
AGGTTCCTGGTCTCATAATGCTTTGTCTAGACTTCCTTACATGTCTTTTTCATATATATGATGGTTTCCAGTGTTGTGTT
TTATAGGAGTTCTGTGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20453089..20453266 174
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es