Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_125.1H12-3
Clone ID CMHD-GT_125.1H12-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_125.1H12-3
Sequence
AACCTGAGACAGGAGGATCTTGAGTTGGAGTCCTGCCTGGGCATTATTGAAACCTGAAGAGACCTGTTAAAAACTCTTTT
CCAGCTGTATCCACAGATCCTCCGTGCTGGTCACCTGGACTTTGTGACAGGGTTTTAAGTTTACTGCTCGAATGTCTTTC
CTCACTATTTACTTGTTAAGTAAGTAGGTTCCTGGTGTGTATGCCTTTTATAGGGTTTTTCACTTATAAGAGCACAGCAC
GAGTGGATAACAAAAACAAAAAAAACAAAGATAAAAGTTTACTGCTCTTGTGTTTTTCATAACTAATTAATTGTTAAGTA
AGTAGTTTCCTGGTGTGTATGCCTTTTTTAGGGTTTTTCAATTAAAAGAGCACAGCAAGAA
Sequence Type mRNA
Unitrap ID UNI14004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130386769..130387152 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025535 (4930579G22Rik) RIKEN cDNA 4930579G22 gene Gene [Source:MGI Symbol;Acc:MGI:1923099]

 
Come back to gene ENSMUSG00000025535


For any suggestions or comments, please send an email to unitrap@crg.es