Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11594D11
Clone ID IST11594D11
Vector VICTR76
Project tigm

Sequence tag IST11594D11HMF1
Sequence
CCTCTACTTTCCTTTGTCCCTCCCANNNAGGCGATGCATTTTCACTTCACGATGATTAAAACCCANCGGCCTACNATACT
ATATTAGTTCACCCAGGCTTCTCANAATCGTGTGTTAAAATCNAAACTGAAACATCATGGAGGTGGGAAGGTCTACTCAT
TANAGTANGTGATCCTGCCNTTCCTGTNNAGCTNTTCTGAGTGTTGGTGCTATTAAAAAAATANGCATGAGATTCATGGT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11594D11BBF1
Sequence
CCTCTACTTTCCTTTGTCCCTCCCAGAGAGGCGATGCATTTTCACTTNACGATGATTAAAACCCAGCGGCCTACGATACT
ATATTAGTTCACCCAGGCTTCTCAGAATCGTGTGTTAAAATCGAAACTGAAACATCATGGAGGTGGGAAGGTCTACTCAT
TAGAGTAGGTGATCCTGCCAGTTCCTGTAGAGCTATTCTGAGTGTTGGTGCTATTAAAAAAATAGGCATGAGATTCNTGG
NAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53957779..53958025 241
NO GENE  


Sequence tag IST11594D11HMR1
Sequence
GGTTCTTCTTANGAACCNNGTGAAGCTTGCCAGGCCCAAGCAGGAAACATCGAGCAGCTTCTCAGAAGACAGAGCCAAGA
CCACGTTAGAATTATCNGGTACCCATCAGCATCATGGGCTGATAATTATCTCTGAGGGTTAGTTAGCATGGTCGATGTGT
GATCTGCGAGGCAAAAGTGGGGCCTCGGGACTCTCGAGTTTGTACTTCANAGTGAAGCC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53958024..53958241 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es