Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12687H12
Clone ID IST12687H12
Vector VICTR76
Project tigm

Sequence tag IST12687H12BBF1
Sequence
GGCCCTTGTCCTTTGCCCCTTCCTGAGTGTGGATTAATGGGGATGTGGN
Sequence Type genomic DNA
Unitrap ID UNI24596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175542385..175542432 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]


Sequence tag IST12687H12HMF1
Sequence
GGCCCTTGTCCTTTGCCCCTTCCTGAGTGTGGATTAATGGGGATGTGGGAAGCTCAGTAGCCCTAGTAGCTTGTGGGCTT
GGGTACCAAAGGTTTTCCACGGAGATCTCTTGCCAGCCTTGGTGGGAGGGTTCCAGCAAATAGAAAGGAATGCAGGCAGG
GAGGGGAAGTTGCAAACCTGCTTTTGCAGTGCCAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI6522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177573762..177573961 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es