Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14296E10
Clone ID IST14296E10
Vector VICTR74
Project tigm

Sequence tag IST14296E10BBF1
Sequence
ACGCTGGTTTGTTAATTGTTTCCAATCNTGGANCTGGTCTTTTTACTTTTTTNAAAAAATGAAATTGATTCCTGTANCCG
GGTANTGGTGGCACACNCCTTTAATCCCANCACTCGGNAGGCANAGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14296E10HMF1
Sequence
GCTGGTTTGTTAATTGTTTCCNATCNTGGATCTGGTCTTTTTACTTTTTTNAAAAAATGAAATTGATTCCNGTAGCCGGG
TAGTGGTGGCACACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAGGCCAGCCTGGTCTA
CAGTGANTTCCAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122821231..122821405 165
NO GENE  


Sequence tag IST14296E10HMR1
Sequence
ACAGAAATTACTTCTATTAAAGAACAAGAAAGATATCATGTGGCTAAGTACAGGAACCAAGCAAACTACAGGCTTGATCT
CACTGTAGAATTAGACTAGGACGCTATGAGACCAGATTTACCTAAGTCCTTTCTGGTAAAGTAAATATTAGACTAGGGAT
CCAGCTTGGTGGTAGTAGAGCACTTGTATAGTGTTGGTTAGCCCTGAGTTCNANCNCCCAGTAACATACNCACACTCACA
CGTTCATCCTAGTATGCTAAAAATCTGACCACTCACTTANAAAAAGCTGTATTCTTTTTTGTANCCNATCTANAGGAGAA
ACTTGGTAAGACATTGATGGANACN
Sequence Type genomic DNA
Unitrap ID UNI34243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122820850..122821193 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029463 (1500011H22Rik) NM_026883 RIKEN cDNA 1500011H22 gene Gene [Source:MGI Symbol;Acc:MGI:1916198]

 
Come back to gene ENSMUSG00000029463


For any suggestions or comments, please send an email to unitrap@crg.es