Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14919F10
Clone ID IST14919F10
Vector VICTR76
Project tigm

Sequence tag IST14919F10HMF1
Sequence
AATCTGAAATTTCCTATTGACTTTCCAAAAGTCTGAGCAGGGCCAGTTATAATGATGGACAGTTGTAATGCCAGCACTCA
AGGCAAAAGCGGAAGGAAAGGCCAGTAAGTACCAGACAGACAGAGAAGAGGAAGTAGGGAGGGACGGAGACCAAGACCAC
TGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60651483..60651645 163
NO GENE  


Sequence tag IST14919F10HMR1
Sequence
NANTNNNNNNNNNNANTGTNNNNCNNANNNNNNCNNNNNNNNNNCNTTGGCCCTGTTTCCTTATAGTGTGGCTCANTATT
GCATGATTGCCTTTTTACCNACCTGGACCAATTCCTCCCTATGCCCTGGAGAGTTCTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60651689..60651790 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es