Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15009G7
Clone ID IST15009G7
Vector VICTR78
Project tigm

Sequence tag IST15009G7HMF1
Sequence
CTCTGTGGCTGGGTGACTATCCATGCAGGCTGGGATAGAGGCACAGAAGGCATCCCTACTGGCGTGTGCTGGAGAAGCTG
AGTAGTACTGGTCACATACGTGCAGGGACTTAGGGGCGGGCAGGGGCCTTCANAAGGTACAGAANAGCTCANAGGCACCA
GGAAAGCTGCACTACCTGAGCANAGGCAGGAGGGCAGGGATAGAGTGGGGACACTTGANNTGGAANAACANGATGCTNTG
TTN
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10307670..10307911 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


Sequence tag IST15009G7HMR1
Sequence
AGAGGACCTCCAATGCTATGGTCGGTCTCCCAGGGTGAACTACGCTCCAAGATTCACTCAGTCCACATAGCAGTAAGGCA
CAGTGGGTTGTCACAGTTCTCTGACCTANACTATCTTCACTGATACCCAAAGCTGCTTGCTGGCCCTGTTCAAGCTTCCA
GTCGCAACCTGGGCCGTCTCAATGGAATGCCTGCAGCTTGGATGTGCACGCAGCTCTGCACTGATGTATCAGGTTCTCAG
TCNNTTTGGGTCNNNCAGCCACACCTAAGAGCAATGCAGCTCTGGTCCTAGCAAACCCTCAAGCCTAAGTCACGGCTGTC
TGTGTCCCTCCNANTTNNNNACCAAAGACTCANAANANGCTCCAAGGCCTGATCCANAGCACCAAATAANTGGGTGTGGT
GGANTATGCCNGNNNANNNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es