Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10084B10
Clone ID IST10084B10
Vector VICTR75
Project tigm

Sequence tag IST10084B10BBR1
Sequence
TTTAACTTTTACTCTAGAGGGAGATTCTATAGTTCCTGTTCCGTTGCAAAGGCTTTGCTCGGGCTTAGGCTTCCGGGGGG
GTAGAGTCCATCACAGCGGAGGGCACACTGGCAAGCTAGATGACCACGCTTACCCACACACAGCGAGCAGAGAGTGGACA
GAGCATAGAGCCAGGCTGTAAGCCCCAGCCAGTAATGTCCTCTCCTCCAGCCAGCCTCTGCTGCCTAAGCAGTGCCACCA
GCCGAGAGCTAAGTGTGGAGTTCCGTGAGAATTTCACATTCAAATGACCTCTGAGATACAGAAAGACAGAAGCGAGTGGG
AAGACCCCCGTGGGTGCAAGCTCACTCCAGACTGCTCTGCTCGTTTGCCTTAGGGATGGGAGGTTGGCGATAATTGCCCC
TGCTGAAGGCCTCCTCTTCGAGCATAGCTTCTTCTCTCAAGCCACAGAGTCTCTTCAGATTTTTCCAGTTGTCCAAAGAC
AACTGTGAAATGTGAACGTCTCTGGATTTTGAGACAAGGTCTTTCTCTGAAGCTCTGGCTGGCCTGGAACGCTTAGTCTT
TGTGCTCTAG
Sequence Type genomic DNA
Unitrap ID UNI34246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122474597..122475166 568
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]


Sequence tag IST10084B10BBF1
Sequence
GAAACATGTGCGTGAGCTGGGTACATTTCAGTTATCCAAGCCCAACTTTCTCACTGCTCTACTAGGAAATGAACAACAGC
TGGCTTTTGATGTATGCTAAGCACTGCTGATGGACAGGAGACTTCTAACTGTGCATGCCTGCACATGTACATGCATGCCC
ATGTGTATGTATCGATAGCACAGACACGTGACCTTCCTTGAAGCCACTATCAGGCAAACAGTCTCACCCAGAAGAACCTA
CTTTCGTGCGTGGGTGAGAGTAGCTTCTTCAGGCTCAGCATCTCTTCATGGAGTCCATTGAGGATGAAACCTAGATACTC
CTCTGCGTCCTCCTGCCGGCCCTGAGGACAGACATGGGCACATTAATTCCAACCAGCTGGAGTAAGGCCTATAGAAGCCC
CAGCACCTAGAGCAAACTACACCTTAGATGAATGCTCTAGACCAGTGAACCCCAAATCCCCAGAGTTGCCATGAGAACTC
TGTAGCCTATTTCTATAGCTAACCTCCTAGGCACAGATACTGGTACACACAAGCTGGTCTTAGACAATAGCGCCACTCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122474041..122474599 556
NO GENE  

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es