Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12216B1
Clone ID IST12216B1
Vector VICTR76
Project tigm

Sequence tag IST12216B1BBF1
Sequence
TGGGTAGTCTGTGTCATCAGGGCGTGATTGTATGGATTTTATTTTTCTTCCCCTATTTTCATGTGTGTGANCTAANTATG
TACATGTACAGGTGAATGCCTGAGGTTGCTGTTANAATCACCCTTCATTGCTCTTCCNACTTCTTCATTGAGGCAGGCTC
TCTTCTTACATGAAGTACCGATACGGCCAGCTTTTCGAGCTANCTTTCTCTGGGCTTTGCTTGTCTCTGCTTCCAAGGCT
GCAGTTACTGGGTGAAATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101951149..101951409 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es