Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_109C9-3
Clone ID CMHD-GT_109C9-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_109C9-3
Sequence
GATGCCCTGGACGCTCTGGGCCTAAAGCGCTACTGCTGCCGCCGCATGCTGCTAGCACACGTGGACCTGATTGAGAAGCT
GCTGAACTATGCACCCCTAGAGAAGTGACCGCTGGAGCCTGCCCTCCTCTGTCTCCTGCTGGCCACGGGCAGCCTGTCGT
GCTATGTTCAAACTGAGCTATTGGGGATGTTGGTGTATTGCCTGGCTGTGGCCCTGTGGGCTAGTCCTGTTACCCTGGAA
GGAACTGTTTAATTAAGATGGTTGGAGAACC
Sequence Type mRNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659032..148659302 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126534927..126535197 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074846 (AL732330.14)  

 
Come back to gene ENSMUSG00000074846


For any suggestions or comments, please send an email to unitrap@crg.es