Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14745E3
Clone ID IST14745E3
Vector VICTR76
Project tigm

Sequence tag IST14745E3BBF1
Sequence
AATGTGCCAGGACAGCCAGGGCTATACAGAGAAACCNGNCNNANACNNAANTATTTATGANNAGAAAAAAATANAAATTA
CATATGTATGAAATTTTCAAAAAAATAAATTTAAAATATTAAGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14745E3HMF2
Sequence
AATGTGCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCAAAACAAACG
Sequence Type genomic DNA
Unitrap ID UNI30695 UNI30696 UNI30697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 129942155..129942211 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036086 (Zranb3) NM_027678 zinc finger, RAN-binding domain containing 3 Gene [Source:MGI (curated);Acc:Zranb3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856278..12856334 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68724065..68724121 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55914251..55914307 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5555061..5555117 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 123209495..123209551 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34706010..34706066 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015468 (Notch4) NM_010929 Notch gene homolog 4 (Drosophila) Gene [Source:MGI (curated);Acc:Notch4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6269298..6269354 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 147520210..147520266 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 45789225..45789281 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54152649..54152705 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30609823..30609879 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073102 (Gm1060) NP_001028632 gene model 1060, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685906]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29585573..29585629 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107559269..107559325 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11161848..11161904 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44146667..44146723 55
NO GENE  

 
Come back to gene ENSMUSG00000073102


For any suggestions or comments, please send an email to unitrap@crg.es