Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0251
Clone ID AE0251
Vector pGT0lxr
Project sanger

Sequence tag AE0251
Sequence
TGTGATTTTCCAATCTCGGGTCCTCGCTCCTTCTTCTTTTTGCATTTACTCAGGATTACTACAGTGGTGGCTACTATCCT
GCACCGGACCCGGCTCTGGTCCCTCCCCAGGAAATTGCCCCTGATGCCTCCTTCATTGATGATGAAGCATTTAAGCGGCT
ACAGGGCAAGAGGAACCGAGGGAGAGAGGAAATCAACTTTGTGGAGATCAAAGGTGATGACCAACTCAGTGGGGCTCAGC
AGTGGATGACCAAGTCACTGACAGAAGAGAAAACCATGAAGTCCTTCAGCAAA
Sequence Type mRNA
Unitrap ID UNI2322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87666053..87671334 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004895 (Prcc) NM_033573 papillary renal cell carcinoma (translocation-associated) Gene [Source:MGI Symbol;Acc:MGI:2137738]

 
Come back to gene ENSMUSG00000004895


For any suggestions or comments, please send an email to unitrap@crg.es