Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14978H9
Clone ID IST14978H9
Vector VICTR76
Project tigm

Sequence tag IST14978H9HMR1
Sequence
CTGATGTACAGGCCCTCCCTCCCACTCCACTGCCCCAATAAATATAAATAAATAATAAGCAAACAAAGGAATGAAAGTCC
AAGTTTTAAGATCAGTGAGAGACCTGAAGTTAAAAATGATCTGTTGAATAGTTGAAAACTTACTGTTGGTANAACTTGTT
ATTTCAAATAAAAACGATTCTAAAACTAAAAATAGAGGTATGTGTCACAGTGAAGTATGTGGAAAGTGACGGATGAGTCT
GGCCANCTTA
Sequence Type genomic DNA
Unitrap ID UNI23799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138021989..138022237 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]


Sequence tag IST14978H9HMF1
Sequence
CAGGGCTCATGTGTGGAGATCAGAGAACAAGTTTTGGAAATGTGTTTTTTCCTTTTACCATGTGGATTCTAGGAGTCAGC
TCAGGTCCTCAGACTTGGCCCGTCTCACCCACTGAGCTCTCTCTCGGCCCCTAAAAGGAGGATTATGCTTTTCAACTTCT
TACATCTATCCCAGAGACTTACAAGGAACAACAAAATTGAAAGTCCATTTCCATCACAGAATGACACCACTCAGTGGACA
GCTCATGATAAAAGGACTACATCTGCCCAAGAACATCAATGTTTCANTAATTCTTCCAATAGCAACACTCACAGTCCTAG
GCAGANCATCTCANATCTGTGATNNATCAAAACACTTTCTATTANAAACAGANTNTGCCTCNNNTNANNCNNATANNCNN
NTTNNACCNNNNGANGTTCAAATAANANTACANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es