Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0220
Clone ID AE0220
Vector pGT0lxr
Project sanger

Sequence tag AE0220
Sequence
GCGGGACGCCGCGTCCCGAGCGGCCGGCGGCCGGAGCTCGCCCCCGCCCCTCCCTCCTCTCTTCCGGCGGCGGCGGCGGC
GGGCGGAGTGAGCTGCGGAGCCTGGAATATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTATT
TGATGCAGCTGATGAACGACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTG
CTGGACGAAGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACGTTAAATGGCAGTACAGAGAAAAGAAGTGCAGA
ATTGCCTGACGCGGTGGGACCCATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCNGATCTTAACT
NNGANGGGAGAATCCNNGGACCNAGAGGACNGACAGCNAAACAACGNGAAGCAGAAACGGGANGAAAATAANNGGTCNGA
GNCAANNNNTTTACCCCGCGTATCGATGTCGACTTTTTTTTTTTTTTTTCGACTATCCTCCAACCTATTCATTTTTTTAT
ATTA
Sequence Type mRNA
Unitrap ID UNI2323

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10322641..10511846 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es