Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14227D10
Clone ID IST14227D10
Vector VICTR74
Project tigm

Sequence tag IST14227D10HMF1
Sequence
CCCTCTCCGGCCCTGTGCACACGGTTAGACCCGAAAACTTGGCATAAGTTTCCCGCGCGTGGCTCGGGGCATTGCACAGC
CACTGCGCATGCGTGCTTCTGCATCCGTTGAGGGGCAACTTGAGAGGAATCCTCCACGCTGCACCTGGTTTTTCACTCTC
CTGGGTGCCGCTAAAGTTCGCGGGAAACGCGTGGGGTCCGGCGGGGAAGTGCACGCGGCTCCACGCCTAAGANCGGACAC
TCCCCNNNATTNAATTGTCGCGCCCGAGTCGGGTTTCGCGCGCCCAGGCGTCTCCGAGGTCATCTAGGCCAATCGCATGC
GAGGAGGGCGGGGCACGTANCCCGGGAGGAGCCAATCANCNGCGANCTCTNCCGGGANNGGCGGANCTTAAC
Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443278..56443667 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]


Sequence tag IST14227D10BBF1
Sequence
CCCTCTCCGGCCCTGTGCACACGGTTANACCCGAAAACTTGGCATAAGTTTCCCGCGCGTGGCTCGGGGCATTGCACAGC
CACTGCGCATGCGTGCTTCTGCATCCGTTGAGGGGCAACTTGAGAGGAATCCTCCACGCTGCACCTGGTTTTTNACTCTC
CTGGGTGCCGCTAAAGTTCGCGGGAAACGCGTGGGGTCCGGCGGGGAAGTGCACNCGGCTCCACGCCTAANANCGGACAC
TCCCCGANANTCAATTGTCGCGCCCGANTCGGGTTTCNCGCNCCCAGGCGTCTCCNNNNNNNTCTAGGCNAATCGCATGC
NAGGAGGGCGGGGCACGTANCCCGGGNNGANCCAATNNNCAGCGANCTCTCNNNGANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es