Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947B9
Clone ID IST14947B9
Vector VICTR76
Project tigm

Sequence tag IST14947B9HMR1
Sequence
GTCNCACAGTTCANAGTTCTCAATGCCTCCCTCCCTAACCCAGTCCTCAAGCCTTTCAGGAAGTGCCCGGAGGCCCCCTT
TTTAGTCATTGGCCGTCCCTCGCTCCGGGTCCAGGATAGGGCGGAGCATAGAAAGCCGGAGCCAGGCGCGCGCCCTGACG
CGAGGACCGAANAACTGCTTTGCCTATCAAGTTCTCACCTCTTTGTCTGCCGCCTTCTCCTCAATGCCGAGCAGCGCGTA
CAGATCCATTTGTAAGAGCTCTTTGGTCACCGCCATGGTTCTAGTCCAAACTTGAATTGATACTACAACTCCCAGGAGTC
TGAGCGTGTGCGTGGGCGCGGGGCTTACTCGCTCCGAGCCGGCCCAAAAGCGCGCTAAGCCTCCTGGGATGATGCCTTCC
GATTCTCGTCTGACTGGCTGTGGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119034226..119034649 418
 
EST/CDNA Est Name
  NM_139139.1 - BC013487.1


Sequence tag IST14947B9BBF1
Sequence
CGTGCTGTCCCTTCTGNNNNACTGTTTGGAGGCCGGTTGAACCTGAGAGCCCAGGCCTGCTTTTTTGCGCCTGCGCANCA
TCANTTTGTACGCTGAACGTTTTACCTGTCTGTCTGGAGGTGTTTGGTTTTANTCTGTTTTAACTTCAGGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14947B9HMF1
Sequence
CGTGCTGTCCCTTCTGCCACACTGTTTGGAGGCCGGTTGAACCTGAGAGCCCAGGCCTGCTTTTTTGCGCCTGCGCAGCA
TCAGTTTGTACGCTGAACGTTTTACCTGTCTGTCTGGAGGTGTTTGGTTTTAGTCTGTTTTAACTTCAGGGGGATCCTAG
GAAGAAAAGTCTCTAGGCTCTAACTCCTCCCCTCAGCCCCTCTTCTTTTTCTGGATTTGACGTTGAGGCCTAGAACCTAN
AGGCCTCAGTTTTCTTTTCCTCTTTTTAAGTATCANATGTTCCAATGTTGTCAGTGCGTGCTGCTTANCGGGTTAAACAA
GAGGATCAGAAGGNNAAAGCAGGTGGTGTGGGGGTCCACTTATCTNAAGTGCTGTACTTAANGTTNNTGTNNTTTACTCT
TANANNGNGGTGN
Sequence Type genomic DNA
Unitrap ID UNI2177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119033814..119034225 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]

 
Come back to gene ENSMUSG00000034278


For any suggestions or comments, please send an email to unitrap@crg.es