Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14588C6
Clone ID IST14588C6
Vector VICTR74
Project tigm

Sequence tag IST14588C6HMF3
Sequence
GTGCCAACCCTGGGCAAGTGTTCCTGGGTTCTGTAAGAAAGCATGCTGAGCAAGCCAGGGGGAGCAAGCCAGTAAAGAGC
ACCCCTCCATGCCCCTGCATCAGCTCCTGCCTTCAGGTTCCTGCCCTGACTTCCTCCCTCAATGACAGAAGCCAAATAAA
CCGTTTGTTACCCAAGCTGCTTTTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60653480..60653669 190
NO GENE  


Sequence tag IST14588C6BBF2
Sequence
GTGCCAACCCTGGGCAAGTGTTCCTGGGTTCTGTAAGAAAGCATGCTGAGCAAGCCAGGGGGAGCAAGCCAGTAAAGAGC
ACCCCTCCATGCCCCTGCATCAGCTCCTGCCTTCAGGTTCCTGCCCTGACTTCCTCCCTCAATGACAGAAGCCAAATAAA
CCGTTTGTTACCCAAGCTGCTTTTGGCCAGTGTCTCATCACAGTGATAATAACCCTAACTAAGACACGTTCATTTTTCCA
CTACTCAAATACCCTTTTCTACGATGCAGTACACATAAACACACCTATGGGCCCCCGGACTGCTTAGACCTTCCAGGCTT
CTCTGTGTTTTTTGTTTGTTTGTTTTGNGTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60653296..60653669 368
NO GENE  


Sequence tag IST14588C6HMR1
Sequence
GGCACCACCCGCAATGCACTGCATAAGTCACTAATTACGAAATGCCTTACAACTGGATCTTAAGGAGGCATTTTCTCAN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60653665..60653742 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es