Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14604H3
Clone ID IST14604H3
Vector VICTR74
Project tigm

Sequence tag IST14604H3HMR1
Sequence
NNNANTGTCATTCAATTNANACNAGCCACACCTGGGGCCNCATGTGGATCATGAGCACTGCATTGTGTGGCTCAGAGTTC
CCTGGGGAGTGCACGGGATGGCAGTCTGTGACATCTGTGACAACCAATACCACAGTGCATTTGTCCCTTTAATGTTGGGG
TGGCAAAAGGAAGCCATTTGTAGGTGCCTCAATAAAGAGGCAAAGGGGGAGGATGACACAAAGGCCTGATGGGGAGGGTG
ACCCTTGTGCTCANGCTTGGANTTANAATAGGGTTTTGAACAGCAGGCNTGGGTGGAANGCTGCTNTN
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202869..157203168 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]


Sequence tag IST14604H3BBF2
Sequence
ATGTGAGACAGGCATGGTTGGGCTANCANNATGGCTCANCAGGTAANAGCACTGACTGCTCTTCCAAAGGTCCCGAGTTC
AAATCCCAACAACCACATGGTGGCTCACAACTCTCCAAAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8765313..8765441 119
NO GENE  

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es