Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0197
Clone ID AE0197
Vector pGT0lxr
Project sanger

Sequence tag AE0197
Sequence
CCTGGACGACAACGAGAGTGGGGCTACACGCGGAGGGACACCACGGCCATGACTGCGGAGCTGCAGCAGGACGACTCGGC
GGGGGCGGCGGACGGCCATGGCTCG
Sequence Type mRNA
Unitrap ID UNI2326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48793542..48793642 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es