Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14617G12
Clone ID IST14617G12
Vector VICTR74
Project tigm

Sequence tag IST14617G12HMR1
Sequence
GAACACACCTTTAATCTGGGCNACACCTTTTGCTGGAGACAATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTTGCTC
TTGCTCCTTCGCCTGCTTGCTGCGTGAGACTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGCTGCGACTGAACCA
TTGTTGGGAATTGGGCTGCCGACTGTAAGTCATCAATAAATTCCTTTACTATTTANAAATTATCCATAAGTTCTGTGACT
CTANANAACCCTGACTAATACAGAAGTTGGTACCAGGAGTGGTTCTAGAGTAACAGAAGTACAAGGATGAATCTTTTAAA
ATACTGGAATTGGCTTGTTGATCCACNNNCACTTTCAAATATTGANNCCTCTCCAGANTCTCTCCCTCCTGGGAGCTCAN
AGNATTTTGAANACCCATGGTTGAAACTATATTCCGAACTTANNNAANCTNATGCNNNTGANTNTCTTAATGAANTANNT
GATTCNGTGCACNNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14617G12BBF1
Sequence
TGTTCCACCACACCTTTAATCCCAGATGAAAGGCATAGCCCAGATTAAAGGTGTGTTCCTTAACTCGGAGATTCAATCTT
CTGGAATCCATAGCCACTATGGCTCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI9273 UNI30944 UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13197872..13197983 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6149263..6149374 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19465580..19465691 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9510605..9510716 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3020517..3020628 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 5074132..5074243 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878797..16878908 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819108..31819219 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36657533..36657644 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658307..4658418 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17092593..17092704 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3850267..3850378 112
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23941433..23941544 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8415652..8415763 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32977030..32977141 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7731246..7731357 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19355172..19355283 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7260227..7260338 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20423889..20424000 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3269877..3269988 112
NO GENE  


Sequence tag IST14617G12HMF2
Sequence
TGTTCNNCCACACCTTTAATCCCAGANGAAAGGCATAGCCCAGATNAAAGGTGTGTTCCTTAACTCGGANATTCAATCTT
CTGGAATCCATAGCCNCTATGGCTCAAGATCTTCAAACCAAGATCCAGATAAGGATCTCCAAGCCTCCAGATAAGGGTCA
CTGGTGAGCCTTCCAATTCCGGATTGTAGTTNATTCCAAATATTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30944 UNI30945 UNI31256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17092593..17092804 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658307..4658518 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66654186..66654397 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56287873..56288084 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 30939814..30940025 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022240 (Ctnnd2) NM_008729 catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3020517..3020728 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9510605..9510816 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19465580..19465791 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20423889..20424100 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 5074132..5074343 198
 
EST/CDNA Est Name
  AA063893.1 - AI644954.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6149263..6149474 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7260227..7260438 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7731246..7731457 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19355172..19355383 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62663279..62663490 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8415652..8415863 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 23941433..23941644 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4737802..4738013 198
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3850267..3850478 198
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16612276..16612487 198
NO GENE  

 
Come back to gene AI930322.1


For any suggestions or comments, please send an email to unitrap@crg.es