Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13016B5
Clone ID IST13016B5
Vector VICTR76
Project tigm

Sequence tag IST13016B5HMR1
Sequence
ATATATGTATATATTTACATATATATATATATACATACATACATATAATGTTATGTN
Sequence Type genomic DNA
Unitrap ID UNI34256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41550026..41550081 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025766 (D3Ertd751e) NM_028667 UPF0462 protein C4orf33 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BGN2]

 
Come back to gene ENSMUSG00000025766


For any suggestions or comments, please send an email to unitrap@crg.es