Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14788G2
Clone ID IST14788G2
Vector VICTR76
Project tigm

Sequence tag IST14788G2HMR1
Sequence
CCTTGNNTTCCNAATCTANATCCACCTCCAGCACTTACTTGCAATTTTGCAGATTGAGAGGCTCTGAGACCCCTCTGCCA
TTCATCCTTCAGCCCTAGATTCCCATCTCCCCTGACTCACCTGCTCCCAGAGGCTCTGCCATGGGCGCTCTCCCTGCTTC
TGGGAAGGCCCTCCACTCCGCTGCAGCCGGCTCACCTCCCGCCTTANGCTTTGCAGCTCTGTCTGTTGGATCANTAGTGC
GACAGCACANNTCACANCCCCCANAACTGCCCCCCAACTCAACCAAAGAGCAACCGAAAGGGCTGGCTCTCTGACTGAGC
CCCCCATGTGGCCTGGAGATGANGCTGGCATGAGCTAGGGACCCTGCCAACAGCTGTGGTCTCANAAGTGANGTGNCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498411..69498809 371
 
EST/CDNA Est Name
  NM_023517.2


Sequence tag IST14788G2BBF1
Sequence
AAGGGAACAGCCATTTAAGGAAAATAAACACCCTGAAAGGCAGTCAGTGCCCAGATCAGGGGCCTATGACAGATACATAC
ATTTCAGTTATTCCTGGTGTTGAGGAGGGCTGGGAAGAAGGTTGTCTGAGACCCTTAACATCTTAGTCAAACTCTGGCCC
TCTTTCATGAGCAGAGTCCTGATGTCCTGGAAGCCTGGAAGGATGGGGCGAAATCTCGGAGAAGGAGAGCAGTACTCACC
CAGAAGCACAAGAGTGAGTGAGCCCTGGGGTTTCGGTGCGGTTGGCGGTGACCCAGGAGCACGAGGGATGCGGAGCAGGG
CTGAGGTGAGGGTGGACTCCNGGGCANGTCAACACTGCTGNNNNNNCCTTCTTTCCTTANAGAAGCACTCNNTCCTGCNT
CTTGTTCCAGTTNNNATTACCTCCNNNGGTAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14788G2HMF1
Sequence
AAGGGAACAGCCATTTAAGGAAAATAAACACCCTGAAAGGCAGTCAGTGCCCAGATCAGGGGCCTATGACAGATACATAC
ATTTCAGTTATTCCTGGTGTTGAGGAGGGCTGGGAAGAAGGTTGTCTGANACCCTTANNANCTTANTCNANNNCNGGA
Sequence Type genomic DNA
Unitrap ID UNI14358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498267..69498414 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es