Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11696H2
Clone ID IST11696H2
Vector VICTR76
Project tigm

Sequence tag IST11696H2HMR1
Sequence
NGAGAAGATCCTCTGGTTAGAGCACTGCTTTTCAGAGCTGTTATTCTAGTGTACTTTCTTGTGTATCCTAAATATTTGGA
AATTGATGTCCCTCTCCTAATCCCTCCCAGTTCACATCCTTGCTCACAATCAACTCAGGTGTGTTCATTCTGTCTCCTTG
TTTTCCTTATTTCACCAGGACATCCTAATTGTGTCCAGAAATCTTGAATATTGATTAGCCCANAAATACTATAATTACAC
TATATCATGATGTTAAATCAACAGGTTTCTTTCTTGANGNNNNATGCTTCCTTANGTNNGAGAAGTANAANANTNCTTTG
AAAAATATTTNANANNTN
Sequence Type genomic DNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28156041..28156369 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST11696H2HMF1
Sequence
CTCATGAAGCACACTGAACAAAGCCNGAAGATGGTCTCACATACTGGGAGCTTTCTCTCCCTGGAAGTGGTAAACAGAGA
TCGAATGCATCCANCAGCTANATGAGAGCTGGGCACCTGTTCCCAGCANACCANGGCACTCTGATGCGGTGACCTANGGT
CATTTCCCTANCANGTTCTATTTGTTTTTTAAGTCCCTGGAANCAAANCCTGTTTTGCTTCTCCTTCCTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11696H2BBF1
Sequence
NTCATGAAGCACACTGAACAAAGCCNGAANATGGTCTCACATACTGGGAGCTTTCTCTCCCTGGAAGTGGTAAACAGAGA
TCGAATGCATCCANCAGCTANATGAGAGCTGGGCACCTGTTCCCAGCANACCAGGGCACTCTGATGCGGTGACCTANGGT
CATTTCCCTANCANGTTCTATTTGTTTTTTAAGTCCCTGGAANCAAANCCTGTTTTGCTTCTCCTTCCTNCNNANNGNNN
NNNCCANGAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es