Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12297A3
Clone ID IST12297A3
Vector VICTR76
Project tigm

Sequence tag IST12297A3HMF2
Sequence
CTATTAATTAAGTTAAATAAGGCAACGCTTAACTGAGGTGATCAAATGATTTTCTCATCCGTAGATGAGTGGGCTTTTAA
CCTTGGCTTGGGTGGACATGGACCCGATTCCTCCCGTGGGTAAAACCCACACATGTGGCTCTTGGTACCTTTTGGGGAGG
CGAGGTAGAGCCGGAGAATATTTTTTATTTTTAACCAAAATTTGGTACCAACCTCTTTCAAACCGGGTTTATCTCACAGG
AAACTCAGAAATGGTCAAGCCGGACCTTCCCTTGCAGTAAGTATCTCTGCACCAAGCGGTGCCCATACTGAATTTGTACA
ATCACAAACCAGTATGCACAGTTCTGAGTGCTGTGCAGCTCCTAAAGGAGAATTATCAACCTCAGAATTAGCAAAGCCTA
AGCAAGAATTATGTCGTTAATAACACCACGATTTGTGGGTAAAATAGGAGCTGGAAGTCGTTCCTCCTCATCCCTGTTTT
TTCCACAGCCTATTGAGCTNNNNCACCTTGCAGTAACAGCAAGGGTGAAAAGCCAGN
Sequence Type genomic DNA
Unitrap ID UNI15587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 44878434..44878970 525
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19314886..19315422 525
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 69663273..69663809 525
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8761880..8762416 525
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55707235..55707771 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88517951..88518487 525
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21201737..21202273 525
NO GENE  


Sequence tag IST12297A3BBF1
Sequence
GTGGTAAGTGTAGCCTCATGTGGGAGGTGATATCTAAGCCACAGATCCATGGATGAGTTATGTTTATAGTGGTAGAAAGC
AGAGGAAGGGAGAACCTGGACACAGGGGTGACNGTGATGTATTTATGCAAGAGAAGCGAGCAGCTTGCCTGTGGAAAGTA
GGTGAACAGATGTGATTTCTAGAGTGAGTGTTAGAATCCTGCTTTGGTCAAGTTGTGGGGGGGGGGAGCTAANCCACTCA
GGGTTAANTATATCTTAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62634105..62634367 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es