Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10083F10
Clone ID IST10083F10
Vector VICTR75
Project tigm

Sequence tag IST10083F10BBF1
Sequence
AAAACAAACAAACAAAAACTATTAACTGTTGAGTCTTCTCTCTAGCACCAGTGGAATAGGTCTCAAAGGGAAAAAATTGG
TGCTACAGCAACTGATTGGCTTGGATAATAGATTTATATAAATCATTCCTCTTTGTATTATAGTCGGGGTCACTGTGACT
TTGCTATCGGCTATGTCAACAGCCCAGGAGGGCTACAAAGCTTGGCTCCTTGTCCTTTAAAAAAACGGATAGATTTAATT
TTTTTATTTTATTTGCATTAGTGTTTAGTGTGTGCCCAGTGCCCAGGGAGGCTGGAAGAGGACCTTGGATCTCTTGGAAA
TGGAATTACAGATGATTGTGACCCCACCAGTTGAATGCTGGGAATCATATCCTGGTCCCCCGAAAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135167892..135168286 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST10083F10BBR1
Sequence
GTTTTATTTTGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCC
TTGAACTCGGTTAATAGTTCTTAGTACTCTTGCAGAGGACCCAAGTTTGGTTCCCAGTAGCCACATCAGGCAGCTCACAA
CCACCTGTATCTCCAGCCCTCTTCTAGCCTCTGTAGGTTCCTGGAGATGGGTGGTACACATAAACTCACACAAACTTAGT
CATAGCTAGGAAGAAGGGATCACAAATGAGGAAATGCCTCTATCGGAGAGGCCGTTAGGAAGGTCTGTGGGGTACTGTCT
TGATTAATGATTGATGTGGGAGCACTGAGCCCACTGTGGGCGGTGCTATCCCTAGACAGGTGGTCCTGCTTATATGAGAA
AGTAGGCTGGGAGAGACACGAGGAGCAAACCAGTTAAGTGGCATTCCTCCTTCTACACTTCTGCTTCAGTTCCAGTAGAC
TGTGACTCAGGATGTGTGTGCTGACGACTTTATGTCAACTTGACACAAGCTAGAGTCATCTGAGAGGAGGGAACTTCAGC
CATGTGTTGGTGCTGTACACCTTTAATCAGAGTACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135167302..135167896 588
NO GENE  

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es