Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12409G6
Clone ID IST12409G6
Vector VICTR76
Project tigm

Sequence tag IST12409G6BBF1
Sequence
AAAGGAACAATCATTTTGTTATTTGTCCTGAAAAGTAATTTTTAAAATTATTCACTTTACACCCCAGTATCAGCCCCACC
TATCTCCTCCCAGTCCTCCCTTCACACAGCTCAGCTCCCCCCCCATTCCCTCTCTTCCTCTGAGAAGGGGGAAGCTCCCC
TGGGTACCACACACACACACACACACACACACTCACACACACACACACANACACACTCACACACACACACACACACACAC
ACAN
Sequence Type genomic DNA
Unitrap ID UNI30801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52729741..52729983 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]


Sequence tag IST12409G6HMF1
Sequence
AAAGGAACAATCATTTTGTTATTTGTCCNGAAAAGTNATTTTNAAAATTATTCANTTNNCACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es