Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981H5
Clone ID IST14981H5
Vector VICTR76
Project tigm

Sequence tag IST14981H5HMF1
Sequence
GGCCAATGTATTTTACTGGGCATACTACATGTATTTTTGAGACGCCATTGAACTCTTGCATCACATAATGAGGTTAAGGG
TATTCTAGAACATGTGTGTGCACTTCAGCTTANAAAGCTACAAATGGGCTAATGTAACAATTATTCTAAGTTGTGTAGAA
GCCCTAGTGTGACCAGATTCTATAATAGAGTCATTATAAGGCAACCCTTTTCTTCTTCAATTTTGGACAGAACACCCCCT
CCACACACATACACAGAACCCANGACTGCNAACCTACTCAGGGCTATTTGCTCTCTGGATCCCTGGTCTGCATTCACTCC
ATAAAAATGTGGGAAGATGATTACATATNTTAANGGGTTTATTTTCNNANNAANTNANANTGCNNCTGATTANAA
Sequence Type genomic DNA
Unitrap ID UNI13980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452188..33452579 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020159 (Gabrp) NM_146017 gamma-aminobutyric acid (GABA-A) receptor, pi Gene [Source:MGI (curated);Acc:Gabrp-001]


Sequence tag IST14981H5BBF1
Sequence
GGCCAATGTATTTTACTGGGCATACTACATGTATTTTTGAGACGCCATTGAACTCTTGCATCACATAATGAGGTTAAGGG
TATTCTAGAACATGTGTGTGCACTTCAGCTTAGAAAGCTACAAATGGGCTAATGTAACAATTATTCTAAGTTGTGTAGAA
GCCCTAGTGTGACCAGATTCTATAATAGAGTCATTATAAGGCAACCCTTTTCTTCTTCAATTTTGGACAGAACACCCCCT
CCACACACATACACAGAACCCAAGACTGCGAACCTACTCAGGGCTATTTGCTCTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452279..33452579 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020159 (Gabrp) NM_146017 gamma-aminobutyric acid (GABA-A) receptor, pi Gene [Source:MGI (curated);Acc:Gabrp-001]


Sequence tag IST14981H5HMR1
Sequence
GGCCNACATAAAAATCNAAGGAAATAGTAGTTTGGAGTATCGATCCACATTGCTGGGGTTTTGAATTGTGAAATAATCAA
TGATTCTGCTGATCTTCTCTCGGAAGACAAACTTAAACTTGTCGCTGGCTTTCATTGTCAAGTCACTATAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452576..33452728 149
NO GENE  

 
Come back to gene ENSMUSG00000020159


For any suggestions or comments, please send an email to unitrap@crg.es