Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14931A9
Clone ID IST14931A9
Vector VICTR76
Project tigm

Sequence tag IST14931A9HMR1
Sequence
TTTTGCTTTATAGAAAACTCGGCAGTTAGCACTTGTCTAANATCACACTCAAGAACACAAAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132834453..132834515 61
NO GENE  


Sequence tag IST14931A9HMF2
Sequence
AGTTTCAAATGAACTGGGCACCCAAAGGGCCAGTATCTAGCCTGAGGAAGCACAGTGGTTTCCCTTCTTTGGTGGCTGTG
TGTCCACAGGTCGCTGTGGTGCACCACACATGTGGGGCCAGGACCATGCTGCACCCAGATAGGCTGCCAGAACTGATCTA
TAGTGCGCATCCCCCCTCTCCCCACAGCCACTGGAGGGACGGCTGATCACAGGGAGGATGTTAGGACCCTTCCCAGCCTC
TGTAGCATGTGTGAGCCTGTAACTTTGGTGAGTTCTGAAAGGGAAGGAAAACTACAACTGANCAGCTTCTTGAATAACTT
TCCTCCTCTTCCTCCCGTGCCTAGTTTCCCTGANTTTGATGCTACCCCTGATGCNNAACNNNNGGCTTTTATGCNCGGAG
AAAGTCTCCNGTTNANCTGGGTGTGGTGGTGCANACN
Sequence Type genomic DNA
Unitrap ID UNI14987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45595410..45595845 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST14931A9BBF1
Sequence
GGGCGAGGGACTCATGTGGCCCTGTCTTTCCTTGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737569..33737609 41
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es