Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10545B9
Clone ID IST10545B9
Vector VICTR76
Project tigm

Sequence tag IST10545B9HMR1
Sequence
TAGGAATAAGGTCCCAAGGCTCCCCACCATCGTTCCTGAGACCTTCTGAGTTCTCAAGTTCATCCGCTCTCTCCTGCCTC
GTCTCTCTTGTGCCTCTTTCTTCAGCCTCTCTTTTGTATATAAAGGACGATGTGATTATATTGGACCCATCCAGATAACC
CATCTCTCTCCCTAAGATCAGCTGCTTANTAACCTTCACGGCAATGTCCCACATTGTTGAAATGTAAAGCAAGGTTTGCC
CCTGGAGTCTCTCTCCTTGAANCCTTTCTTTAAGTGACATTCACAGTTCTGTGATGATGCACCCTGGATTTCTAATAGGG
AGGTTTGGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI15899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46113671..46114002 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es