Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14309B10
Clone ID IST14309B10
Vector VICTR74
Project tigm

Sequence tag IST14309B10HMF2
Sequence
GTTCAATTCCCAGCAACCACTAGCCCCCCCAACCATCTTTTATGATTCAACACCCTGTTCTGGCCTCGGAGGGCACCAGG
TACGCACTACACATTTAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97908669..97908775 107
NO GENE  


Sequence tag IST14309B10BBF1
Sequence
GTTNATNNNATAGCAGTTGAAAACAACACCCATAAGGGTTTTGTTACCTAGTTTTAATCTCTGAGCTGGGTTTTGTGCCT
GTTTGTTTATTAGGTTGGTTGGTTTTGAGGGTTCAAATCTAACTANATGCTGACTACAGTTTCATTGTTAACAATGAAAC
AATTTAAAACACAAATGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97907108..97907289 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060739 (5730427N09Rik) NM_021552 RIKEN cDNA 5730427N09 gene Gene [Source:MGI Symbol;Acc:MGI:1913883]

 
Come back to gene ENSMUSG00000060739


For any suggestions or comments, please send an email to unitrap@crg.es